Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human IDE cDNA Clone in Mammalian Expression Vector

This is a Insulin-Degrading Enzyme plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: not_set. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3390189
Supplier Product No.: sc327546
$497.97
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 21 to 22 Business Days

Quick Overview for Human IDE cDNA Clone in Mammalian Expression Vector (ABIN3390189)

Gene

IDE (Insulin-Degrading Enzyme (IDE))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc327546

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human IDE is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    IDE (Insulin-Degrading Enzyme (IDE))

    Alternative Name

    IDE

    Background

    This gene encodes a zinc metallopeptidase that degrades intracellular insulin, and thereby terminates insulins activity, as well as participating in intercellular peptide signalling by degrading diverse peptides such as glucagon, amylin, bradykinin, and kallidin. The preferential affinity of this enzyme for insulin results in insulin-mediated inhibition of the degradation of other peptides such as beta-amyloid. Deficiencies in this protein's function are associated with Alzheimer's disease and type 2 diabetes mellitus but mutations in this gene have not been shown to be causitive for these diseases. This protein localizes primarily to the cytoplasm but in some cell types localizes to the extracellular space, cell membrane, peroxisome, and mitochondrion. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but have not been experimentally verified.[provided by RefSeq, Sep 2009].Transcript Variant: This variant (2) lacks multiple exons that are present in the 5' end of variant 1. Variant 2 contains a novel exon at its 5' end and begins translation from a downstream in-frame start codon, compared to variant 1. The encoded protein (isoform 2) lacks 555 amino acids from the N-terminus of isoform 1 but is identical to its C-terminal 464 amino acids. Compared to isoform 1, isoform 2 lacks two of three M16 peptidase domains and the N-terminal catalytic domain. The C-terminus of isoform 2 retains the oligomerization domain and peroxisomal targeting sequence present in isoform 1.

    NCBI Accession

    NM_001165946, NP_001159418
You are here: