Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human ITGAM cDNA Clone in Mammalian Expression Vector

This is a Integrin alpha M plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3700 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3390321
Supplier Product No.: sc326511
$1,490.94
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 2 to 4 Business Days

Quick Overview for Human ITGAM cDNA Clone in Mammalian Expression Vector (ABIN3390321)

Gene

CD11b (ITGAM) (Integrin alpha M (ITGAM))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc326511

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human ITGAM is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3700 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Badarau, Rouha, Malafa, Logan, Håkansson, Stulik, Dolezilkova, Teubenbacher, Gross, Maierhofer, Weber, Jägerhofer, Hoffman, Nagy: "Structure-function analysis of heterodimer formation, oligomerization, and receptor binding of the Staphylococcus aureus bi-component toxin LukGH." in: The Journal of biological chemistry, Vol. 290, Issue 1, pp. 142-56, (2015) (PubMed).

    DuMont, Yoong, Day, Alonzo, McDonald, Jennings, Torres: "Staphylococcus aureus LukAB cytotoxin kills human neutrophils by targeting the CD11b subunit of the integrin Mac-1." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 110, Issue 26, pp. 10794-9, (2013) (PubMed).

  • Target

    CD11b (ITGAM) (Integrin alpha M (ITGAM))

    Alternative Name

    ITGAM

    Background

    This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

    NCBI Accession

    NM_001145808, NP_001139280
You are here: