Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human KCNJ11 cDNA Clone in Mammalian Expression Vector

This is a Potassium Inwardly-Rectifying Channel, Subfamily J, Member 11 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: not_set. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3390370
Supplier Product No.: sc327451
$326.70
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 21 to 22 Business Days

Quick Overview for Human KCNJ11 cDNA Clone in Mammalian Expression Vector (ABIN3390370)

Gene

KCNJ11 (Potassium Inwardly-Rectifying Channel, Subfamily J, Member 11 (KCNJ11))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc327451

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human KCNJ11 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    KCNJ11 (Potassium Inwardly-Rectifying Channel, Subfamily J, Member 11 (KCNJ11))

    Alternative Name

    KCNJ11

    Background

    Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and is found associated with the sulfonylurea receptor SUR. Mutations in this gene are a cause of familial persistent hyperinsulinemic hypoglycemia of infancy (PHHI), an autosomal recessive disorder characterized by unregulated insulin secretion. Defects in this gene may also contribute to autosomal dominant non-insulin-dependent diabetes mellitus type II (NIDDM), transient neonatal diabetes mellitus type 3 (TNDM3), and permanent neonatal diabetes mellitus (PNDM). Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2009].Transcript Variant: This variant (2) uses a different segment for its 5' UTR and lacks 5' coding region sequence, compared to variant 1. Variant 2 uses a downstream start codon, which results in a protein (isoform 2) with a shorter N-terminus when it is compared to isoform 1.

    NCBI Accession

    NM_001166290, NP_001159762
You are here: