Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human KLF4 cDNA Clone in Mammalian Expression Vector

This is a Kruppel-Like Factor 4 (Gut) plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2900 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3390455
Supplier Product No.: sc327870
$1,336.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human KLF4 cDNA Clone in Mammalian Expression Vector (ABIN3390455)

Gene

KLF4 (Kruppel-Like Factor 4 (Gut) (KLF4))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc327870

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human KLF4 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2900 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Ohnesorge, Viemann, Schmidt, Czymai, Spiering, Schmolke, Ludwig, Roth, Goebeler, Schmidt: "Erk5 activation elicits a vasoprotective endothelial phenotype via induction of Kruppel-like factor 4 (KLF4)." in: The Journal of biological chemistry, Vol. 285, Issue 34, pp. 26199-210, (2010) (PubMed).

    Huesca, Lock, Khine, Viau, Peralta, Cukier, Jin, Al-Qawasmeh, Lee, Wright, Young: "A novel small molecule with potent anticancer activity inhibits cell growth by modulating intracellular labile zinc homeostasis." in: Molecular cancer therapeutics, Vol. 8, Issue 9, pp. 2586-96, (2009) (PubMed).

    Reidling, Said: "Regulation of the human biotin transporter hSMVT promoter by KLF-4 and AP-2: confirmation of promoter activity in vivo." in: American journal of physiology. Cell physiology, Vol. 292, Issue 4, pp. C1305-12, (2007) (PubMed).

  • Target

    KLF4 (Kruppel-Like Factor 4 (Gut) (KLF4))

    Alternative Name

    KLF4

    Background

    This gene encodes a protein that belongs to the Kruppel family of transcription factors. The encoded zinc finger protein is required for normal development of the barrier function of skin. The encoded protein is thought to control the G1-to-S transition of the cell cycle following DNA damage by mediating the tumor suppressor gene p53. Mice lacking this gene have a normal appearance but lose weight rapidly, and die shortly after birth due to fluid evaporation resulting from compromised epidermal barrier function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015].

    NCBI Accession

    NM_004235, NP_004226
You are here: