Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human MAPKAPK3 cDNA Clone in Mammalian Expression Vector

This is a Mitogen-Activated Protein Kinase-Activated Protein Kinase 3 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2560 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3390722
Supplier Product No.: sc323455
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human MAPKAPK3 cDNA Clone in Mammalian Expression Vector (ABIN3390722)

Gene

MAPKAP Kinase 3 (MAPKAPK3) (Mitogen-Activated Protein Kinase-Activated Protein Kinase 3 (MAPKAPK3))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc323455

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human MAPKAPK3 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2560 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    MAPKAP Kinase 3 (MAPKAPK3) (Mitogen-Activated Protein Kinase-Activated Protein Kinase 3 (MAPKAPK3))

    Alternative Name

    MAPKAPK3

    Background

    This gene encodes a member of the Ser/Thr protein kinase family. This kinase functions as a mitogen-activated protein kinase (MAP kinase)- activated protein kinase. MAP kinases are also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This kinase was shown to be activated by growth inducers and stress stimulation of cells. In vitro studies demonstrated that ERK, p38 MAP kinase and Jun N-terminal kinase were all able to phosphorylate and activate this kinase, which suggested the role of this kinase as an integrative element of signaling in both mitogen and stress responses. This kinase was reported to interact with, phosphorylate and repress the activity of E47, which is a basic helix-loop-helix transcription factor known to be involved in the regulation of tissue-specific gene expression and cell differentiation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011].Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.

    NCBI Accession

    NM_004635, NP_004626
You are here: