Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human MASP1 cDNA Clone in Mammalian Expression Vector

This is a Mannan-Binding Lectin Serine Peptidase 1 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1300 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3390741
Supplier Product No.: sc302611
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human MASP1 cDNA Clone in Mammalian Expression Vector (ABIN3390741)

Gene

MASP1 (Mannan-Binding Lectin Serine Peptidase 1 (MASP1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc302611

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human MASP1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1300 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    MASP1 (Mannan-Binding Lectin Serine Peptidase 1 (MASP1))

    Alternative Name

    MASP1

    Background

    This gene encodes a serine protease that functions as a component of the lectin pathway of complement activation. The complement pathway plays an essential role in the innate and adaptive immune response. The encoded protein is synthesized as a zymogen and is activated when it complexes with the pathogen recognition molecules of lectin pathway, the mannose-binding lectin and the ficolins. This protein is not directly involved in complement activation but may play a role as an amplifier of complement activation by cleaving complement C2 or by activating another complement serine protease, MASP-2. The encoded protein is also able to cleave fibrinogen and factor XIII and may may be involved in coagulation. A splice variant of this gene which lacks the serine protease domain functions as an inhibitor of the complement pathway. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010].Transcript Variant: This variant (3) differs in the 3' UTR and 3' coding region, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. This isoform (3) is referred to as MAp44 or MAP1 in the literature.

    NCBI Accession

    NM_001031849, NP_001027019
You are here: