Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human MET cDNA Clone in Mammalian Expression Vector

This is a Met Proto-Oncogene plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 5000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3390801
Supplier Product No.: sc316318
$1,766.16
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human MET cDNA Clone in Mammalian Expression Vector (ABIN3390801)

Gene

c-MET (MET) (Met Proto-Oncogene (MET))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc316318

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human MET is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    5000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Shin, Hong, Moon, Kim, Jung, Kim, Lee, Kim, Yoon, Lee, Choi, Lee, Kim, Hong, Lee, Kim, Choi, Lee, Jin, Kim: "NPS-1034, a novel MET inhibitor, inhibits the activated MET receptor and its constitutively active mutants." in: Investigational new drugs, Vol. 32, Issue 3, pp. 389-99, (2014) (PubMed).

    Lovly, Heuckmann, de Stanchina, Chen, Thomas, Liang, Pao: "Insights into ALK-driven cancers revealed through development of novel ALK tyrosine kinase inhibitors." in: Cancer research, Vol. 71, Issue 14, pp. 4920-31, (2011) (PubMed).

    Tyner, Fletcher, Wang, Yang, Rutenberg-Schoenberg, Beadling, Mori, Heinrich, Deininger, Druker, Loriaux: "MET receptor sequence variants R970C and T992I lack transforming capacity." in: Cancer research, Vol. 70, Issue 15, pp. 6233-7, (2010) (PubMed).

    Ng, Jackson, Buschdorf, Sun, Guy, Sivaraman: "Structural basis for a novel intrapeptidyl H-bond and reverse binding of c-Cbl-TKB domain substrates." in: The EMBO journal, Vol. 27, Issue 5, pp. 804-16, (2008) (PubMed).

  • Target

    c-MET (MET) (Met Proto-Oncogene (MET))

    Alternative Name

    MET

    Background

    The proto-oncogene MET product is the hepatocyte growth factor receptor and encodes tyrosine-kinase activity. The primary single chain precursor protein is post-translationally cleaved to produce the alpha and beta subunits, which are disulfide linked to form the mature receptor. Various mutations in the MET gene are associated with papillary renal carcinoma. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the end of an exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.

    NCBI Accession

    NM_000245, NP_000236
You are here: