Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human MMP7 cDNA Clone in Mammalian Expression Vector

This is a Matrix Metallopeptidase 7 (Matrilysin, Uterine) plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1140 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3390899
Supplier Product No.: sc122627
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human MMP7 cDNA Clone in Mammalian Expression Vector (ABIN3390899)

Gene

MMP7 (Matrix Metallopeptidase 7 (Matrilysin, Uterine) (MMP7))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc122627

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human MMP7 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1140 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Oelusarz, Nichols, Grunz-Borgmann, Chen, Akintola, Catania, Burghardt, Trzeciakowski, Parrish: "Overexpression of MMP-7 Increases Collagen 1A2 in the Aging Kidney." in: Physiological reports, Vol. 1, Issue 5, (2013) (PubMed).

    Chen, Li, Li, Wang, Xie: "DKK1 promotes hepatocellular carcinoma cell migration and invasion through β-catenin/MMP7 signaling pathway." in: Molecular cancer, Vol. 12, pp. 157, (2013) (PubMed).

  • Target

    MMP7 (Matrix Metallopeptidase 7 (Matrilysin, Uterine) (MMP7))

    Alternative Name

    MMP7

    Background

    This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This secreted protease breaks down proteoglycans, fibronectin, elastin and casein and differs from most MMP family members in that it lacks a conserved C-terminal hemopexin domain. The enzyme is involved in wound healing, and studies in mice suggest that it regulates the activity of defensins in intestinal mucosa. The gene is part of a cluster of MMP genes on chromosome 11. This gene exhibits elevated expression levels in multiple human cancers. [provided by RefSeq, Jan 2016].

    NCBI Accession

    NM_002423, NP_002414
You are here: