Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human MS4A2 cDNA Clone in Mammalian Expression Vector

This is a Membrane-Spanning 4-Domains, Subfamily A, Member 2 (Fc Fragment of IgE, High Affinity I, Receptor For, beta Polypeptide) plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 900 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3390949
Supplier Product No.: sc300015
$330.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human MS4A2 cDNA Clone in Mammalian Expression Vector (ABIN3390949)

Gene

MS4A2 (Membrane-Spanning 4-Domains, Subfamily A, Member 2 (Fc Fragment of IgE, High Affinity I, Receptor For, beta Polypeptide) (MS4A2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc300015

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human MS4A2 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    900 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    MS4A2 (Membrane-Spanning 4-Domains, Subfamily A, Member 2 (Fc Fragment of IgE, High Affinity I, Receptor For, beta Polypeptide) (MS4A2))

    Alternative Name

    MS4A2

    Background

    The allergic response involves the binding of allergen to receptor-bound IgE followed by cell activation and the release of mediators responsible for the manifestations of allergy. The IgE-receptor, a tetramer composed of an alpha, beta, and 2 disulfide-linked gamma chains, is found on the surface of mast cells and basophils. This gene encodes the beta subunit of the high affinity IgE receptor which is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This family member is localized to 11q12, among a cluster of membrane-spanning 4A gene family members. Alternative splicing results in multiple transcript variants encoding distinct proteins. Additional transcript variants have been described but require experimental validation. [provided by RefSeq, Mar 2012].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1) that traffics to the cytoplasmic membrane.

    NCBI Accession

    NM_000139, NP_000130
You are here: