Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human NAIP cDNA Clone in Mammalian Expression Vector

This is a NLR Family, Apoptosis Inhibitory Protein plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 6000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3391027
Supplier Product No.: sc303496
$1,981.10
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human NAIP cDNA Clone in Mammalian Expression Vector (ABIN3391027)

Gene

NAIP (NLR Family, Apoptosis Inhibitory Protein (NAIP))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc303496

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human NAIP is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    6000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Kortmann, Brubaker, Monack: "Cutting Edge: Inflammasome Activation in Primary Human Macrophages Is Dependent on Flagellin." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 195, Issue 3, pp. 815-9, (2015) (PubMed).

    Halff, Diebolder, Versteeg, Schouten, Brondijk, Huizinga: "Formation and structure of a NAIP5-NLRC4 inflammasome induced by direct interactions with conserved N- and C-terminal regions of flagellin." in: The Journal of biological chemistry, Vol. 287, Issue 46, pp. 38460-72, (2012) (PubMed).

    Vinzing, Eitel, Lippmann, Hocke, Zahlten, Slevogt, Nguessan, Günther, Schmeck, Hippenstiel, Flieger, Suttorp, Opitz: "NAIP and Ipaf control Legionella pneumophila replication in human cells." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 180, Issue 10, pp. 6808-15, (2008) (PubMed).

  • Target

    NAIP (NLR Family, Apoptosis Inhibitory Protein (NAIP))

    Alternative Name

    NAIP

    Background

    This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This copy of the gene is full length, additional copies with truncations and internal deletions are also present in this region of chromosome 5q13. It is thought that this gene is a modifier of spinal muscular atrophy caused by mutations in a neighboring gene, SMN1. The protein encoded by this gene contains regions of homology to two baculovirus inhibitor of apoptosis proteins, and it is able to suppress apoptosis induced by various signals. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

    NCBI Accession

    NM_004536, NP_004527
You are here: