Human VND cDNA Clone in Mammalian Expression Vector
Quick Overview for Human VND cDNA Clone in Mammalian Expression Vector (ABIN3391123)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc304088
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human NKX2 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 800 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human VND cDNA Clone in Mammalian Expression Vector]()
Human VND cDNA Clone in Mammalian Expression VectorcDNA PExp Mammalian Expression Vector pCMV6-XL5 Ampicillin Enhanced CMV Promoter unconjugated Transient
![Human VND cDNA Clone in Mammalian Expression Vector]()
Human VND cDNA Clone in Mammalian Expression VectorcDNA PExp Mammalian Expression Vector pCMV6-XL5 Ampicillin Enhanced CMV Promoter unconjugated Transient
![Mouse VND cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Mouse VND cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Human VND cDNA Clone in Mammalian Expression Vector]()
Human VND cDNA Clone in Mammalian Expression VectorcDNA PExp Mammalian Expression Vector pCMV6-XL5 Ampicillin Enhanced CMV Promoter unconjugated Transient
![Human VND cDNA Clone in Mammalian Expression Vector]()
Human VND cDNA Clone in Mammalian Expression VectorcDNA PExp Mammalian Expression Vector pCMV6-XL5 Ampicillin Enhanced CMV Promoter unconjugated Transient
![Human VND cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human VND cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Mouse VND cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Mouse VND cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Mouse VND cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Mouse VND cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Mouse VND cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Mouse VND cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Mouse VND cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Mouse VND cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- NKX2 (VND) (Ventral Nervous System Defective (VND))
-
Alternative Name
- NKX2
-
Background
- The protein encoded by this gene is a homeobox-containing developmental regulator associated with liver development. The encoded protein binds to the alpha-fetoprotein (AFP) gene promoter and increases the expression of AFP. This gene is overexpressed in some lung cancers and is linked to poor patient survival, possibly due to its resistance to cisplatin. This gene is aberrantly methylated in pancreatic cancer, deleted in squamous cell lung carcinomas, and acts as a tumor suppressor in esophageal cancer. Mutations in this gene may also be a cause of neural tube defects. [provided by RefSeq, Dec 2015].
-
NCBI Accession
- NM_014360, NP_055175
Target
-
