Human NLRP13 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human NLRP13 cDNA Clone in Mammalian Expression Vector (ABIN3391132)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc307067
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human NLRP13 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3300 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human NLRP13 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human NLRP13 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
![Human NLRP13 shRNA in Retroviral Vector (GFP tag)]()
Human NLRP13 shRNA in Retroviral Vector (GFP tag)shRNA RNAi Retroviral Vector pGFP-V-RS Kanamycin U6 Promoter GFP tag Transient
![Human NLRP13 ORF Clone in Mammalian Expression Vector (GFP tag)]()
Human NLRP13 ORF Clone in Mammalian Expression Vector (GFP tag)ORF PExp Mammalian Expression Vector pCMV6-AC-GFP Ampicillin CMV Promoter GFP tag Stable
![Human NLRP13 shRNA in Retroviral Vector]()
Human NLRP13 shRNA in Retroviral VectorshRNA RNAi Retroviral Vector pRS Ampicillin U6 Promoter unconjugated Transient
![Human NLRP13 shRNA in Lentiviral Vector (GFP tag)]()
Human NLRP13 shRNA in Lentiviral Vector (GFP tag)shRNA RNAi Lentiviral Vector pGFP-C-shLenti Chloramphenicol U6 Promoter GFP tag Transient
![Human NLRP13 CRISPR gRNA + Cas9 in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human NLRP13 CRISPR gRNA + Cas9 in Mammalian Expression Vector (Myc-DYKDDDDK Tag)gRNA + Cas9 GEEN Mammalian Expression Vector pCas-Guide Ampicillin U6 Promoter Myc-DYKDDDDK Tag Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- NLRP13 (NLR Family, Pyrin Domain Containing 13 (NLRP13))
-
Alternative Name
- NLRP13
-
Background
- This gene encodes a member of the NACHT, leucine rich repeat, and PYD containing (NLRP) protein family. It has an N-terminal pyrin domain, followed by a NACHT domain, a NACHT-associated domain (NAD), and a C-terminal leucine-rich repeat (LRR) region. NLRP proteins are implicated in the activation of proinflammatory caspases through multiprotein complexes called inflammasomes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016].
-
NCBI Accession
- NM_176810, NP_789780
Target
-
