Human NR0B2 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human NR0B2 cDNA Clone in Mammalian Expression Vector (ABIN3391185)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc122920
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human NR0B2 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1200 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "The orphan nuclear receptor DAX-1 functions as a potent corepressor of the constitutive androstane receptor (NR1I3)." in: Molecular pharmacology, Vol. 82, Issue 5, pp. 918-28, (2012) (PubMed).
: "Dosage-sensitive sex reversal adrenal hypoplasia congenita critical region on the X chromosome, gene 1 (DAX1) (NR0B1) and small heterodimer partner (SHP) (NR0B2) form homodimers individually, as well ..." in: Molecular endocrinology (Baltimore, Md.), Vol. 20, Issue 10, pp. 2326-42, (2006) (PubMed).
-
-
- NR0B2 (Nuclear Receptor Subfamily 0, Group B, Member 2 (NR0B2))
-
Alternative Name
- NR0B2
-
Background
- The protein encoded by this gene is an unusual orphan receptor that contains a putative ligand-binding domain but lacks a conventional DNA-binding domain. The gene product is a member of the nuclear hormone receptor family, a group of transcription factors regulated by small hydrophobic hormones, a subset of which do not have known ligands and are referred to as orphan nuclear receptors. The protein has been shown to interact with retinoid and thyroid hormone receptors, inhibiting their ligand-dependent transcriptional activation. In addition, interaction with estrogen receptors has been demonstrated, leading to inhibition of function. Studies suggest that the protein represses nuclear hormone receptor-mediated transactivation via two separate steps: competition with coactivators and the direct effects of its transcriptional repressor function. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_021969, NP_068804
Target
-