Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human NR0B2 cDNA Clone in Mammalian Expression Vector

This is a Nuclear Receptor Subfamily 0, Group B, Member 2 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1200 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3391185
Supplier Product No.: sc122920
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human NR0B2 cDNA Clone in Mammalian Expression Vector (ABIN3391185)

Gene

NR0B2 (Nuclear Receptor Subfamily 0, Group B, Member 2 (NR0B2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc122920

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human NR0B2 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1200 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Laurenzana, Chen, Kannuswamy, Sell, Strom, Li, Omiecinski: "The orphan nuclear receptor DAX-1 functions as a potent corepressor of the constitutive androstane receptor (NR1I3)." in: Molecular pharmacology, Vol. 82, Issue 5, pp. 918-28, (2012) (PubMed).

    Iyer, Zhang, McCabe et al.: "Dosage-sensitive sex reversal adrenal hypoplasia congenita critical region on the X chromosome, gene 1 (DAX1) (NR0B1) and small heterodimer partner (SHP) (NR0B2) form homodimers individually, as well ..." in: Molecular endocrinology (Baltimore, Md.), Vol. 20, Issue 10, pp. 2326-42, (2006) (PubMed).

  • Target

    NR0B2 (Nuclear Receptor Subfamily 0, Group B, Member 2 (NR0B2))

    Alternative Name

    NR0B2

    Background

    The protein encoded by this gene is an unusual orphan receptor that contains a putative ligand-binding domain but lacks a conventional DNA-binding domain. The gene product is a member of the nuclear hormone receptor family, a group of transcription factors regulated by small hydrophobic hormones, a subset of which do not have known ligands and are referred to as orphan nuclear receptors. The protein has been shown to interact with retinoid and thyroid hormone receptors, inhibiting their ligand-dependent transcriptional activation. In addition, interaction with estrogen receptors has been demonstrated, leading to inhibition of function. Studies suggest that the protein represses nuclear hormone receptor-mediated transactivation via two separate steps: competition with coactivators and the direct effects of its transcriptional repressor function. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_021969, NP_068804
You are here: