Human ORAI1 cDNA Clone in Mammalian Expression Vector
This is a ORAI Calcium Release-Activated Calcium Modulator 1 plasmid from OriGene - 6 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1400 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(6 references)
Catalog No. ABIN3391302
Supplier Product No.: sc316298
$445.50
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human ORAI1 cDNA Clone in Mammalian Expression Vector (ABIN3391302)
Gene
ORAI1
(ORAI Calcium Release-Activated Calcium Modulator 1 (ORAI1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc316298
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ORAI1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1400 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Selective activation of the transcription factor NFAT1 by calcium microdomains near Ca2+ release-activated Ca2+ (CRAC) channels." in: The Journal of biological chemistry, Vol. 286, Issue 17, pp. 14795-803, (2011) (PubMed).
: "POST, partner of stromal interaction molecule 1 (STIM1), targets STIM1 to multiple transporters." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 108, Issue 48, pp. 19234-9, (2011) (PubMed).
: "Capacitative Ca2+ entry via Orai1 and stromal interacting molecule 1 (STIM1) regulates adenylyl cyclase type 8." in: Molecular pharmacology, Vol. 75, Issue 4, pp. 830-42, (2009) (PubMed).
: "Phosphorylation of STIM1 underlies suppression of store-operated calcium entry during mitosis." in: Nature cell biology, Vol. 11, Issue 12, pp. 1465-72, (2009) (PubMed).
: "Store-dependent and -independent modes regulating Ca2+ release-activated Ca2+ channel activity of human Orai1 and Orai3." in: The Journal of biological chemistry, Vol. 283, Issue 25, pp. 17662-71, (2008) (PubMed).
: "Calcium inhibition and calcium potentiation of Orai1, Orai2, and Orai3 calcium release-activated calcium channels." in: The Journal of biological chemistry, Vol. 282, Issue 24, pp. 17548-56, (2007) (PubMed).
-
: "Selective activation of the transcription factor NFAT1 by calcium microdomains near Ca2+ release-activated Ca2+ (CRAC) channels." in: The Journal of biological chemistry, Vol. 286, Issue 17, pp. 14795-803, (2011) (PubMed).
-
- ORAI1 (ORAI Calcium Release-Activated Calcium Modulator 1 (ORAI1))
-
Alternative Name
- ORAI1
-
Background
- The protein encoded by this gene is a membrane calcium channel subunit that is activated by the calcium sensor STIM1 when calcium stores are depleted. This type of channel is the primary way for calcium influx into T-cells. Defects in this gene are a cause of immune dysfunction with T-cell inactivation due to calcium entry defect type 1 (IDTICED1). [provided by RefSeq, Sep 2011].
-
NCBI Accession
- NM_032790, NP_116179
Target
-
You are here:
