Human PCDH11Y cDNA Clone in Mammalian Expression Vector
Quick Overview for Human PCDH11Y cDNA Clone in Mammalian Expression Vector (ABIN3391406)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc309690
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human PCDH11Y is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 7800 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human PCDH11Y ORF Clone in Lenti Particles (GFP tag)]()
Human PCDH11Y ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human PCDH11Y ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human PCDH11Y ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human PCDH11Y shRNA in Retroviral Vector (GFP tag)]()
Human PCDH11Y shRNA in Retroviral Vector (GFP tag)shRNA RNAi Retroviral Vector pGFP-V-RS Kanamycin U6 Promoter GFP tag Transient
![Human PCDH11Y shRNA in Lentiviral Vector (GFP tag)]()
Human PCDH11Y shRNA in Lentiviral Vector (GFP tag)shRNA RNAi Lentiviral Vector pGFP-C-shLenti Chloramphenicol U6 Promoter GFP tag Transient
![Human PCDH11Y shRNA in Retroviral Vector]()
Human PCDH11Y shRNA in Retroviral VectorshRNA RNAi Retroviral Vector pRS Ampicillin U6 Promoter unconjugated Transient
![Human PCDH11Y CRISPR gRNA + Cas9 in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human PCDH11Y CRISPR gRNA + Cas9 in Mammalian Expression Vector (Myc-DYKDDDDK Tag)gRNA + Cas9 GEEN Mammalian Expression Vector pCas-Guide Ampicillin U6 Promoter Myc-DYKDDDDK Tag Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- PCDH11Y (Protocadherin 11 Y-Linked (PCDH11Y))
-
Alternative Name
- PCDH11Y
-
Background
- This gene belongs to the protocadherin family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing seven cadherin repeats, a transmembrane domain, and a cytoplasmic tail that differs from those of the classical cadherins. This gene is located on the Y chromosome in a block of X/Y homology and is very closely related to its paralog on the X chromosome. The protein is thought to play a role in cell-cell recognition during development of the central nervous system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013].Transcript Variant: This variant (c, also known as Ty3) contains multiple differences in both UTRs and in the coding region, compared to variant a, including initiation of translation at an alternate start codon. The encoded isoform (c) is longer and has distinct N- and C- termini, compared to isoform a.
-
NCBI Accession
- NM_032973, NP_116755
Target
-
