Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PDP cDNA Clone in Mammalian Expression Vector

This is a Pyruvate Dehydrogenase Phosphatase plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: not_set. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3391440
Supplier Product No.: sc327091
$570.24
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 21 to 22 Business Days

Quick Overview for Human PDP cDNA Clone in Mammalian Expression Vector (ABIN3391440)

Gene

PDP (Pyruvate Dehydrogenase Phosphatase (PDP))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc327091

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PDP1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Golias, Papandreou, Sun, Kumar, Brown, Swanson, Pai, Jaitin, Le, Teknos, Denko: "Hypoxic repression of pyruvate dehydrogenase activity is necessary for metabolic reprogramming and growth of model tumours." in: Scientific reports, Vol. 6, pp. 31146, (2016) (PubMed).

  • Target

    PDP (Pyruvate Dehydrogenase Phosphatase (PDP))

    Alternative Name

    PDP1

    Background

    Pyruvate dehydrogenase (E1) is one of the three components (E1, E2, and E3) of the large pyruvate dehydrogenase complex. Pyruvate dehydrogenase kinases catalyze phosphorylation of serine residues of E1 to inactivate the E1 component and inhibit the complex. Pyruvate dehydrogenase phosphatases catalyze the dephosphorylation and activation of the E1 component to reverse the effects of pyruvate dehydrogenase kinases. Pyruvate dehydrogenase phosphatase is a heterodimer consisting of catalytic and regulatory subunits. Two catalytic subunits have been reported, one is predominantly expressed in skeletal muscle and another one is is much more abundant in the liver. The catalytic subunit, encoded by this gene, is the former, and belongs to the protein phosphatase 2C (PP2C) superfamily. Along with the pyruvate dehydrogenase complex and pyruvate dehydrogenase kinases, this enzyme is located in the mitochondrial matrix. Mutation in this gene causes pyruvate dehydrogenase phosphatase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009].Transcript Variant: This variant (2) is the longest transcript. This variant and variant 3 encode the same isoform (2).

    NCBI Accession

    NM_001161779, NP_001155251
You are here: