Human PDP cDNA Clone in Mammalian Expression Vector
Quick Overview for Human PDP cDNA Clone in Mammalian Expression Vector (ABIN3391440)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc327091
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human PDP1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Hypoxic repression of pyruvate dehydrogenase activity is necessary for metabolic reprogramming and growth of model tumours." in: Scientific reports, Vol. 6, pp. 31146, (2016) (PubMed).
-
-
- PDP (Pyruvate Dehydrogenase Phosphatase (PDP))
-
Alternative Name
- PDP1
-
Background
- Pyruvate dehydrogenase (E1) is one of the three components (E1, E2, and E3) of the large pyruvate dehydrogenase complex. Pyruvate dehydrogenase kinases catalyze phosphorylation of serine residues of E1 to inactivate the E1 component and inhibit the complex. Pyruvate dehydrogenase phosphatases catalyze the dephosphorylation and activation of the E1 component to reverse the effects of pyruvate dehydrogenase kinases. Pyruvate dehydrogenase phosphatase is a heterodimer consisting of catalytic and regulatory subunits. Two catalytic subunits have been reported, one is predominantly expressed in skeletal muscle and another one is is much more abundant in the liver. The catalytic subunit, encoded by this gene, is the former, and belongs to the protein phosphatase 2C (PP2C) superfamily. Along with the pyruvate dehydrogenase complex and pyruvate dehydrogenase kinases, this enzyme is located in the mitochondrial matrix. Mutation in this gene causes pyruvate dehydrogenase phosphatase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009].Transcript Variant: This variant (2) is the longest transcript. This variant and variant 3 encode the same isoform (2).
-
NCBI Accession
- NM_001161779, NP_001155251
Target
-