Human PEG10 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human PEG10 cDNA Clone in Mammalian Expression Vector (ABIN3391454)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc328643
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human PEG10 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- PEG10 (Paternally Expressed 10 (PEG10))
-
Alternative Name
- PEG10
-
Background
- This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1, and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation and apoptosis. Overexpression of this gene has been associated with several malignancies, such as hepatocellular carcinoma and B-cell lymphocytic leukemia. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. Additional isoforms resulting from alternatively spliced transcript variants, and use of upstream non-AUG (CUG) start codon have been reported for this gene. [provided by RefSeq, Oct 2014].Transcript Variant: This variant (2) has two overlapping open reading frames (RF1 and RF2). It uses an alternate donor splice site at the 5' terminal exon and initiates translation from an alternate, upstream AUG compared to variant 1. This isoform (4) produced from RF1 in the absence of -1 translational frameshifting has a longer and distinct N-terminus, but a shorter C-terminus compared to isoform 1.
-
NCBI Accession
- NM_001172438, NP_001165909
Target
-