Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PHKA1 cDNA Clone in Mammalian Expression Vector

This is a phosphorylase Kinase, alpha 1 (Muscle) plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: not_set. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3391482
Supplier Product No.: sc329301
$1,091.97
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 31 to 32 Business Days

Quick Overview for Human PHKA1 cDNA Clone in Mammalian Expression Vector (ABIN3391482)

Gene

PHKA1 (phosphorylase Kinase, alpha 1 (Muscle) (PHKA1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc329301

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PHKA1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    PHKA1 (phosphorylase Kinase, alpha 1 (Muscle) (PHKA1))

    Alternative Name

    PHKA1

    Background

    Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, and the skeletal muscle isoform is encoded by this gene. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, which are encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9D, also known as X-linked muscle glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. A pseudogene has been found on chromosome 1.[provided by RefSeq, Feb 2010].Transcript Variant: This variant (3) lacks two alternate in-frame exons in the middle and 3' coding regions, respectively, compared to variant 1, resulting in a shorter protein (isoform 3), compared to isoform 1.

    NCBI Accession

    NM_001172436, NP_001165907
You are here: