Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PMEL cDNA Clone in Mammalian Expression Vector

This is a Premelanosome Protein plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2134 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3391560
Supplier Product No.: sc122763
$914.76
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PMEL cDNA Clone in Mammalian Expression Vector (ABIN3391560)

Gene

Melanoma gp100 (PMEL) (Premelanosome Protein (PMEL))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc122763

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PMEL is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2134 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Zeng, Su, Anderson, Sasada: "Artificial antigen-presenting cells expressing CD80, CD70, and 4-1BB ligand efficiently expand functional T cells specific to tumor-associated antigens." in: Immunobiology, Vol. 219, Issue 8, pp. 583-92, (2014) (PubMed).

    Hofmann, Tenzer, Bannwarth, Messerschmidt, Glaser, Schild, Landfester, Mailänder: "Mass spectrometry and imaging analysis of nanoparticle-containing vesicles provide a mechanistic insight into cellular trafficking." in: ACS nano, Vol. 8, Issue 10, pp. 10077-88, (2014) (PubMed).

    Wei, Yang, Tewary, Li, Li, Chen, Howard, Bustin, Oppenheim: "The Alarmin HMGN1 contributes to antitumor immunity and is a potent immunoadjuvant." in: Cancer research, Vol. 74, Issue 21, pp. 5989-98, (2014) (PubMed).

  • Target

    Melanoma gp100 (PMEL) (Premelanosome Protein (PMEL))

    Alternative Name

    PMEL

    Background

    This gene encodes a melanocyte-specific type I transmembrane glycoprotein. The encoded protein is enriched in melanosomes, which are the melanin-producing organelles in melanocytes, and plays an essential role in the structural organization of premelanosomes. This protein is involved in generating internal matrix fibers that define the transition from Stage I to Stage II melanosomes. This protein undergoes a complex pattern of prosttranslational processing and modification that is essential to the proper functioning of the protein. A secreted form of this protein that is released by proteolytic ectodomain shedding may be used as a melanoma-specific serum marker. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011].Transcript Variant: This variant (3) has a longer 5' UTR and uses an alternate splice site in the 3' coding region, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.

    NCBI Accession

    NM_006928, NP_008859
You are here: