Human PMEL cDNA Clone in Mammalian Expression Vector
Quick Overview for Human PMEL cDNA Clone in Mammalian Expression Vector (ABIN3391560)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc122763
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human PMEL is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2134 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Artificial antigen-presenting cells expressing CD80, CD70, and 4-1BB ligand efficiently expand functional T cells specific to tumor-associated antigens." in: Immunobiology, Vol. 219, Issue 8, pp. 583-92, (2014) (PubMed).
: "Mass spectrometry and imaging analysis of nanoparticle-containing vesicles provide a mechanistic insight into cellular trafficking." in: ACS nano, Vol. 8, Issue 10, pp. 10077-88, (2014) (PubMed).
: "The Alarmin HMGN1 contributes to antitumor immunity and is a potent immunoadjuvant." in: Cancer research, Vol. 74, Issue 21, pp. 5989-98, (2014) (PubMed).
-
-
- Melanoma gp100 (PMEL) (Premelanosome Protein (PMEL))
-
Alternative Name
- PMEL
-
Background
- This gene encodes a melanocyte-specific type I transmembrane glycoprotein. The encoded protein is enriched in melanosomes, which are the melanin-producing organelles in melanocytes, and plays an essential role in the structural organization of premelanosomes. This protein is involved in generating internal matrix fibers that define the transition from Stage I to Stage II melanosomes. This protein undergoes a complex pattern of prosttranslational processing and modification that is essential to the proper functioning of the protein. A secreted form of this protein that is released by proteolytic ectodomain shedding may be used as a melanoma-specific serum marker. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011].Transcript Variant: This variant (3) has a longer 5' UTR and uses an alternate splice site in the 3' coding region, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.
-
NCBI Accession
- NM_006928, NP_008859
Target
-