Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human POSTN cDNA Clone in Mammalian Expression Vector

This is a Periostin plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2500 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3391581
Supplier Product No.: sc325327
$1,060.29
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human POSTN cDNA Clone in Mammalian Expression Vector (ABIN3391581)

Gene

Periostin (POSTN)

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc325327

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human POSTN is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2500 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Hu, Jin, Liu: "Periostin Contributes to Cisplatin Resistance in Human Non-Small Cell Lung Cancer A549 Cells via Activation of Stat3 and Akt and Upregulation of Survivin." in: Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, Vol. 38, Issue 3, pp. 1199-208, (2016) (PubMed).

    Chen, Zheng, Liu, Shi, Qi: "Periostin activates pathways involved in epithelial-mesenchymal transition in adamantinomatous craniopharyngioma." in: Journal of the neurological sciences, Vol. 360, pp. 49-54, (2016) (PubMed).

    Li, Liu, Wei: "Ageing related periostin expression increase from cardiac fibroblasts promotes cardiomyocytes senescent." in: Biochemical and biophysical research communications, Vol. 452, Issue 3, pp. 497-502, (2014) (PubMed).

  • Target

    Periostin (POSTN)

    Alternative Name

    POSTN

    Background

    This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing, and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015].Transcript Variant: This variant (2) lacks two alternate in-frame exons, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.

    NCBI Accession

    NM_001135934, NP_001129406
You are here: