Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PPP2R1B cDNA Clone in Mammalian Expression Vector

This is a Protein Phosphatase 2, Regulatory Subunit A, beta plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2097 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3391615
Supplier Product No.: sc123371
$605.88
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PPP2R1B cDNA Clone in Mammalian Expression Vector (ABIN3391615)

Gene

PPP2R1B (Protein Phosphatase 2, Regulatory Subunit A, beta (PPP2R1B))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc123371

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PPP2R1B is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2097 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Carmen Figueroa-Aldariz, Castañeda-Patlán, Santoyo-Ramos, Zentella, Robles-Flores: "Protein phosphatase 2A is essential to maintain active Wnt signaling and its Aβ tumor suppressor subunit is not expressed in colon cancer cells." in: Molecular carcinogenesis, Vol. 54, Issue 11, pp. 1430-41, (2015) (PubMed).

  • Target

    PPP2R1B (Protein Phosphatase 2, Regulatory Subunit A, beta (PPP2R1B))

    Alternative Name

    PPP2R1B

    Background

    This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes a beta isoform of the constant regulatory subunit A. Mutations in this gene have been associated with some lung and colon cancers. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010].Transcript Variant: This variant (2) differs in the 3' UTR and the 3' coding region, compared to variant 1. The resulting isoform (b) contains a longer and distinct C-terminus compared to isoform a.

    NCBI Accession

    NM_181699, NP_859050
You are here: