Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human RAN cDNA Clone in Mammalian Expression Vector

This is a RAN, Member RAS Oncogene Family plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: not_set. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3391796
Supplier Product No.: sc125968
$538.56
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human RAN cDNA Clone in Mammalian Expression Vector (ABIN3391796)

Gene

RAN (RAN, Member RAS Oncogene Family (RAN))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc125968

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human RAN is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    RAN (RAN, Member RAS Oncogene Family (RAN))

    Alternative Name

    RAN

    Background

    RAN (ras-related nuclear protein) is a small GTP binding protein belonging to the RAS superfamily that is essential for the translocation of RNA and proteins through the nuclear pore complex. The RAN protein is also involved in control of DNA synthesis and cell cycle progression. Nuclear localization of RAN requires the presence of regulator of chromosome condensation 1 (RCC1). Mutations in RAN disrupt DNA synthesis. Because of its many functions, it is likely that RAN interacts with several other proteins. RAN regulates formation and organization of the microtubule network independently of its role in the nucleus-cytosol exchange of macromolecules. RAN could be a key signaling molecule regulating microtubule polymerization during mitosis. RCC1 generates a high local concentration of RAN-GTP around chromatin which, in turn, induces the local nucleation of microtubules. RAN is an androgen receptor (AR) coactivator that binds differentially with different lengths of polyglutamine within the androgen receptor. Polyglutamine repeat expansion in the AR is linked to Kennedy's disease (X-linked spinal and bulbar muscular atrophy). RAN coactivation of the AR diminishes with polyglutamine expansion within the AR, and this weak coactivation may lead to partial androgen insensitivity during the development of Kennedy's disease. [provided by RefSeq, Jul 2008].
You are here: