Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SCN1A cDNA Clone in Mammalian Expression Vector

This is a Sodium Channel, Voltage-Gated, Type I, alpha Subunit plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 6000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3392066
Supplier Product No.: sc327343
$2,463.12
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human SCN1A cDNA Clone in Mammalian Expression Vector (ABIN3392066)

Gene

SCN1A (Sodium Channel, Voltage-Gated, Type I, alpha Subunit (SCN1A))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc327343

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SCN1A is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    6000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Camargos, Bosmans, Rego, Mourão, Schwartz: "The Scorpion Toxin Tf2 from Tityus fasciolatus Promotes Nav1.3 Opening." in: PLoS ONE, Vol. 10, Issue 6, pp. e0128578, (2015) (PubMed).

    Gilchrist, Dutton, Diaz-Bustamante, McPherson, Olivares, Kalia, Escayg, Bosmans: "Nav1.1 modulation by a novel triazole compound attenuates epileptic seizures in rodents." in: ACS chemical biology, Vol. 9, Issue 5, pp. 1204-12, (2014) (PubMed).

  • Target

    SCN1A (Sodium Channel, Voltage-Gated, Type I, alpha Subunit (SCN1A))

    Alternative Name

    SCN1A

    Background

    Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015].Transcript Variant: This variant (1) encodes encodes the longest isoform (1).

    NCBI Accession

    NM_001165963, NP_001159435
You are here: