Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SLC12A5 cDNA Clone in Mammalian Expression Vector

This is a Solute Carrier Family 12 (Potassium-Chloride Transporter) Member 5 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 6000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3392229
Supplier Product No.: sc304801
$1,069.20
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human SLC12A5 cDNA Clone in Mammalian Expression Vector (ABIN3392229)

Gene

KCC2 (SLC12A5) (Solute Carrier Family 12 (Potassium-Chloride Transporter) Member 5 (SLC12A5))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc304801

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SLC12A5 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    6000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Stödberg, McTague, Ruiz, Hirata, Zhen, Long, Farabella, Meyer, Kawahara, Vassallo, Stivaros, Bjursell, Stranneheim, Tigerschiöld, Persson, Bangash, Das, Hughes, Lesko, Lundeberg, Scott, Poduri et al.: "Mutations in SLC12A5 in epilepsy of infancy with migrating focal seizures. ..." in: Nature communications, Vol. 6, pp. 8038, (2015) (PubMed).

    Wei, Akerman, Newey, Pan, Clinch, Jacob, Shen, Wilkins, Ellory: "The potassium-chloride cotransporter 2 promotes cervical cancer cell migration and invasion by an ion transport-independent mechanism." in: The Journal of physiology, Vol. 589, Issue Pt 22, pp. 5349-59, (2011) (PubMed).

    Zhang, Gopalakrishnan, Freiberg, Surowy: "A thallium transport FLIPR-based assay for the identification of KCC2-positive modulators." in: Journal of biomolecular screening, Vol. 15, Issue 2, pp. 177-84, (2010) (PubMed).

  • Target

    KCC2 (SLC12A5) (Solute Carrier Family 12 (Potassium-Chloride Transporter) Member 5 (SLC12A5))

    Alternative Name

    SLC12A5

    Background

    K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008].Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (2, also known as KCC2b) has a distinct N-terminus and is shorter than isoform 1.

    NCBI Accession

    NM_020708, NP_065759
You are here: