Human SLC12A5 cDNA Clone in Mammalian Expression Vector
This is a Solute Carrier Family 12 (Potassium-Chloride Transporter) Member 5 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 6000 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(3 references)
Catalog No. ABIN3392229
Supplier Product No.: sc304801
$962.28
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human SLC12A5 cDNA Clone in Mammalian Expression Vector (ABIN3392229)
Gene
KCC2 (SLC12A5)
(Solute Carrier Family 12 (Potassium-Chloride Transporter) Member 5 (SLC12A5))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc304801
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human SLC12A5 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 6000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Mutations in SLC12A5 in epilepsy of infancy with migrating focal seizures. ..." in: Nature communications, Vol. 6, pp. 8038, (2015) (PubMed).
: "The potassium-chloride cotransporter 2 promotes cervical cancer cell migration and invasion by an ion transport-independent mechanism." in: The Journal of physiology, Vol. 589, Issue Pt 22, pp. 5349-59, (2011) (PubMed).
: "A thallium transport FLIPR-based assay for the identification of KCC2-positive modulators." in: Journal of biomolecular screening, Vol. 15, Issue 2, pp. 177-84, (2010) (PubMed).
-
-
- KCC2 (SLC12A5) (Solute Carrier Family 12 (Potassium-Chloride Transporter) Member 5 (SLC12A5))
-
Alternative Name
- SLC12A5
-
Background
- K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008].Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (2, also known as KCC2b) has a distinct N-terminus and is shorter than isoform 1.
-
NCBI Accession
- NM_020708, NP_065759
Target
-
You are here:
