Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SLIT2 cDNA Clone in Mammalian Expression Vector

This is a Slit Homolog 2 (Drosophila) plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 4700 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3392347
Supplier Product No.: sc316293
$1,943.37
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human SLIT2 cDNA Clone in Mammalian Expression Vector (ABIN3392347)

Gene

SLIT2 (Slit Homolog 2 (Drosophila) (SLIT2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc316293

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SLIT2 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4700 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Liu, Hou, Hu, Wang, Xiao, Mou, De Leon: "Neuronal chemorepellent Slit2 inhibits vascular smooth muscle cell migration by suppressing small GTPase Rac1 activation." in: Circulation research, Vol. 98, Issue 4, pp. 480-9, (2006) (PubMed).

  • Target

    SLIT2 (Slit Homolog 2 (Drosophila) (SLIT2))

    Alternative Name

    SLIT2

    Background

    This gene encodes a member of the slit family of secreted glycoproteins, which are ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. Members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Proteolytic processing of this protein gives rise to an N-terminal fragment that contains the four leucine-rich repeats and five epidermal growth factor repeats and a C-terminal fragment that contains four epidermal growth factor repeats and the cysteine knot. Both full length and cleaved proteins are secreted extracellularly and can function in axon repulsion as well as other specific processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

    NCBI Accession

    NM_004787, NP_004778
You are here: