Human SORT1 cDNA Clone in Mammalian Expression Vector
This is a Sortilin 1 plasmid from OriGene - 5 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2700 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(5 references)
Catalog No. ABIN3392390
Supplier Product No.: sc118300
$1,130.58
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human SORT1 cDNA Clone in Mammalian Expression Vector (ABIN3392390)
Gene
Sortilin 1 (SORT1)
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc118300
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human SORT1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2700 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "SORT1 Mutation Resulting in Sortilin Deficiency and p75(NTR) Upregulation in a Family With Essential Tremor." in: ASN neuro, Vol. 7, Issue 4, (2015) (PubMed).
: "Production and Characterization of a Novel Monoclonal Antibody Against Human Sortilin." in: Monoclonal antibodies in immunodiagnosis and immunotherapy, Vol. 34, Issue 6, pp. 390-5, (2015) (PubMed).
: "Amyloid Precursor-like Protein 2 and Sortilin Do Not Regulate the PCSK9 Convertase-mediated Low Density Lipoprotein Receptor Degradation but Interact with Each Other." in: The Journal of biological chemistry, Vol. 290, Issue 30, pp. 18609-20, (2015) (PubMed).
: "Targeted manipulation of the sortilin-progranulin axis rescues progranulin haploinsufficiency." in: Human molecular genetics, Vol. 23, Issue 6, pp. 1467-78, (2014) (PubMed).
: "Misregulation of human sortilin splicing leads to the generation of a nonfunctional progranulin receptor." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 109, Issue 52, pp. 21510-5, (2012) (PubMed).
-
-
- Sortilin 1 (SORT1)
-
Alternative Name
- SORT1
-
Background
- This gene encodes a member of the VPS10-related sortilin family of proteins. The encoded preproprotein is proteolytically processed by furin to generate the mature receptor. This receptor plays a role in the trafficking of different proteins to either the cell surface, or subcellular compartments such as lysosomes and endosomes. Expression levels of this gene may influence the risk of myocardial infarction in human patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
-
NCBI Accession
- NM_002959, NP_002950
Target
-
You are here:
