Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human Stim2 cDNA Clone in Mammalian Expression Vector

This is a Stromal Interaction Molecule 2 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3900 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3392504
Supplier Product No.: sc314792
$756.36
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human Stim2 cDNA Clone in Mammalian Expression Vector (ABIN3392504)

Gene

Stim2 (Stromal Interaction Molecule 2 (Stim2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc314792

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human STIM2 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3900 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Stathopulos, Zheng, Ikura: "Stromal interaction molecule (STIM) 1 and STIM2 calcium sensing regions exhibit distinct unfolding and oligomerization kinetics." in: The Journal of biological chemistry, Vol. 284, Issue 2, pp. 728-32, (2009) (PubMed).

    Lefkimmiatis, Srikanthan, Maiellaro, Moyer, Curci, Hofer: "Store-operated cyclic AMP signalling mediated by STIM1." in: Nature cell biology, Vol. 11, Issue 4, pp. 433-42, (2009) (PubMed).

    DeHaven, Jones, Petranka, Smyth, Tomita, Bird, Putney: "TRPC channels function independently of STIM1 and Orai1." in: The Journal of physiology, Vol. 587, Issue Pt 10, pp. 2275-98, (2009) (PubMed).

    Wedel, Boyles, Putney, Bird: "Role of the store-operated calcium entry proteins Stim1 and Orai1 in muscarinic cholinergic receptor-stimulated calcium oscillations in human embryonic kidney cells." in: The Journal of physiology, Vol. 579, Issue Pt 3, pp. 679-89, (2007) (PubMed).

  • Target

    Stim2 (Stromal Interaction Molecule 2 (Stim2))

    Alternative Name

    STIM2

    Background

    This gene is a member of the stromal interaction molecule (STIM) family and likely arose, along with related family member STIM1, from a common ancestral gene. The encoded protein functions to regulate calcium concentrations in the cytosol and endoplasmic reticulum, and is involved in the activation of plasma membrane Orai Ca(2+) entry channels. This gene initiates translation from a non-AUG (UUG) start site. A signal peptide is cleaved from the resulting protein. Multiple transcript variants result from alternative splicing. [provided by RefSeq, Dec 2009].Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1.

    NCBI Accession

    NM_020860, NP_065911
You are here: