Human TCF3 cDNA Clone in Mammalian Expression Vector
This is a Transcription Factor 3 (E2A Immunoglobulin Enhancer Binding Factors E12/E47) plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2100 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(1 reference)
Catalog No. ABIN3392613
Supplier Product No.: sc325258
$600.93
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human TCF3 cDNA Clone in Mammalian Expression Vector (ABIN3392613)
Gene
TCF3
(Transcription Factor 3 (E2A Immunoglobulin Enhancer Binding Factors E12/E47) (TCF3))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc325258
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human TCF3 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2100 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "T cell factor 4 is a pro-catabolic and apoptotic factor in human articular chondrocytes by potentiating nuclear factor ?B signaling." in: The Journal of biological chemistry, Vol. 288, Issue 24, pp. 17552-8, (2013) (PubMed).
-
-
- TCF3 (Transcription Factor 3 (E2A Immunoglobulin Enhancer Binding Factors E12/E47) (TCF3))
-
Alternative Name
- TCF3
-
Background
- This gene encodes a member of the E protein (class I) family of helix-loop-helix transcription factors. E proteins activate transcription by binding to regulatory E-box sequences on target genes as heterodimers or homodimers, and are inhibited by heterodimerization with inhibitor of DNA-binding (class IV) helix-loop-helix proteins. E proteins play a critical role in lymphopoiesis, and the encoded protein is required for B and T lymphocyte development. Deletion of this gene or diminished activity of the encoded protein may play a role in lymphoid malignancies. This gene is also involved in several chromosomal translocations that are associated with lymphoid malignancies including pre-B-cell acute lymphoblastic leukemia (t(1,19), with PBX1), childhood leukemia (t(19,19), with TFPT) and acute leukemia (t(12,19), with ZNF384). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Sep 2011].Transcript Variant: This variant (2) differs in the 3' UTR, lacks an exon and includes an alternate exon in the 3' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (E47, also known as Pan-1) is shorter than isoform E12.
-
NCBI Accession
- NM_001136139, NP_001129611
Target
-
You are here:
