Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human TERT cDNA Clone in Mammalian Expression Vector

This is a Telomerase Reverse Transcriptase plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 4000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3392642
Supplier Product No.: sc125522
$1,464.21
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human TERT cDNA Clone in Mammalian Expression Vector (ABIN3392642)

Gene

TERT (Telomerase Reverse Transcriptase (TERT))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc125522

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human TERT is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Yin, Wang, Li, Wei, Shi, Li: "A novel method for banking stem cells from human exfoliated deciduous teeth: lentiviral TERT immortalization and phenotypical analysis." in: Stem cell research & therapy, Vol. 7, pp. 50, (2016) (PubMed).

  • Target

    TERT (Telomerase Reverse Transcriptase (TERT))

    Alternative Name

    TERT

    Background

    Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified, the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

    NCBI Accession

    NM_198253, NP_937983
You are here: