Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human TNFRSF17 cDNA Clone in Mammalian Expression Vector

This is a Tumor Necrosis Factor Receptor Superfamily, Member 17 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1100 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3392783
Supplier Product No.: sc125656
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human TNFRSF17 cDNA Clone in Mammalian Expression Vector (ABIN3392783)

Gene

BCMA (TNFRSF17) (Tumor Necrosis Factor Receptor Superfamily, Member 17 (TNFRSF17))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc125656

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human TNFRSF17 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1100 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Laurent, Hoffmann, Kuhn, Cheng, Chu, Schmidt-Supprian, Hauck, Schuh, Krumbholz, Rübsamen, Wanngren, Khademi, Olsson, Alexander, Hiepe, Pfister, Weber, Jenne, Wekerle, Hohlfeld, Lichtenthaler, Meinl: "γ-Secretase directly sheds the survival receptor BCMA from plasma cells." in: Nature communications, Vol. 6, pp. 7333, (2015) (PubMed).

    Hoffmann, Kuhn, Laurent, Hauck, Berer, Wendlinger, Krumbholz, Khademi, Olsson, Dreyling, Pfister, Alexander, Hiepe, Kümpfel, Crawford, Wekerle, Hohlfeld, Lichtenthaler, Meinl: "The immunoregulator soluble TACI is released by ADAM10 and reflects B cell activation in autoimmunity." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 194, Issue 2, pp. 542-52, (2015) (PubMed).

    Carpenter, Evbuomwan, Pittaluga, Rose, Raffeld, Yang, Gress, Hakim, Kochenderfer: "B-cell maturation antigen is a promising target for adoptive T-cell therapy of multiple myeloma." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 19, Issue 8, pp. 2048-60, (2013) (PubMed).

  • Target

    BCMA (TNFRSF17) (Tumor Necrosis Factor Receptor Superfamily, Member 17 (TNFRSF17))

    Alternative Name

    TNFRSF17

    Background

    The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B/TALL-1/BAFF), and to lead to NF-kappaB and MAPK8/JNK activation. This receptor also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_001192, NP_001183
You are here: