Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human TNNT3 cDNA Clone in Mammalian Expression Vector

This is a Fast Skeletal Troponin T plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: not_set. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3392807
Supplier Product No.: sc310590
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human TNNT3 cDNA Clone in Mammalian Expression Vector (ABIN3392807)

Gene

TNNT3 (Fast Skeletal Troponin T (TNNT3))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc310590

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human TNNT3 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    TNNT3 (Fast Skeletal Troponin T (TNNT3))

    Alternative Name

    TNNT3

    Background

    The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin filaments. The altered conformation permits increased interaction between a myosin head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein, also known as troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B (DA2B). [provided by RefSeq, Oct 2009].Transcript Variant: This variant (1) encodes the longest isoform (1).

    NCBI Accession

    NM_006757, NP_006748
You are here: