Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human TSLP cDNA Clone in Mammalian Expression Vector

This is a Thymic Stromal Lymphopoietin plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1200 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3392906
Supplier Product No.: sc305538
$148.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human TSLP cDNA Clone in Mammalian Expression Vector (ABIN3392906)

Gene

Thymic Stromal Lymphopoietin (TSLP)

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc305538

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human TSLP is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1200 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Lundström, Highfill, Walsh, Beq, Morse, Kockum, Alfredsson, Olsson, Hillert, Mackall: "Soluble IL7Rα potentiates IL-7 bioactivity and promotes autoimmunity." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 110, Issue 19, pp. E1761-70, (2013) (PubMed).

  • Target

    Thymic Stromal Lymphopoietin (TSLP)

    Alternative Name

    TSLP

    Background

    This gene encodes a hemopoietic cytokine proposed to signal through a heterodimeric receptor complex composed of the thymic stromal lymphopoietin receptor and the IL-7R alpha chain. It mainly impacts myeloid cells and induces the release of T cell-attracting chemokines from monocytes and enhances the maturation of CD11c(+) dendritic cells. The protein promotes T helper type 2 (TH2) cell responses that are associated with immunity in various inflammatory diseases, including asthma, allergic inflammation and chronic obstructive pulmonary disease. The protein is therefore considered a potential therapeutic target for the treatment of such diseases. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012].Transcript Variant: This variant (1) encodes the longer isoform (1, also known as lfTSLP). This isoform is found in much lower abundance compared to the shorter isoform sfTSLP (PMID:24850429) and is known to stimulate allergic inflammation in diseases such as asthma and COPD.

    NCBI Accession

    NM_033035, NP_149024
You are here: