Human UGT2B28 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human UGT2B28 cDNA Clone in Mammalian Expression Vector (ABIN3392971)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc305718
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human UGT2B28 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1600 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human UGT2B28 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human UGT2B28 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
![Human UGT2B28 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human UGT2B28 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
![Human UGT2B28 ORF Clone in Mammalian Expression Vector (GFP tag)]()
Human UGT2B28 ORF Clone in Mammalian Expression Vector (GFP tag)ORF PExp Mammalian Expression Vector pCMV6-AC-GFP Ampicillin CMV Promoter GFP tag Stable
![Human UGT2B28 ORF Clone in Mammalian Expression Vector (GFP tag)]()
Human UGT2B28 ORF Clone in Mammalian Expression Vector (GFP tag)ORF PExp Mammalian Expression Vector pCMV6-AC-GFP Ampicillin CMV Promoter GFP tag Stable
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- UGT2B28 (UDP Glucuronosyltransferase 2 Family, Polypeptide B28 (UGT2B28))
-
Alternative Name
- UGT2B28
-
Background
- This gene encodes a member of the uridine diphosphoglucuronosyltransferase protein family. The encoded enzyme catalyzes the transfer of glucuronic acid from uridine diphosphoglucuronic acid to a diverse array of substrates including steroid hormones and lipid-soluble drugs. This process, known as glucuronidation, is an intermediate step in the metabolism of steroids. Two transcript variants encoding different isoforms have been found for this gene. While both isoforms are targeted to the endoplasmic reticulum, only the longer isoform appears to be active. [provided by RefSeq, May 2011].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
-
NCBI Accession
- NM_053039, NP_444267
Target
-
