Human WNT1 cDNA Clone in Mammalian Expression Vector
This is a Wingless-Type MMTV Integration Site Family, Member 1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1200 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(3 references)
Catalog No. ABIN3393095
Supplier Product No.: sc303644
$452.43
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human WNT1 cDNA Clone in Mammalian Expression Vector (ABIN3393095)
Gene
WNT1
(Wingless-Type MMTV Integration Site Family, Member 1 (WNT1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc303644
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human WNT1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1200 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "EMILIN2 down-modulates the Wnt signalling pathway and suppresses breast cancer cell growth and migration." in: The Journal of pathology, Vol. 232, Issue 4, pp. 391-404, (2014) (PubMed).
: "Skeletal characteristics associated with homozygous and heterozygous WNT1 mutations." in: Bone, Vol. 67, pp. 63-70, (2014) (PubMed).
: "Characterization of the interaction of sclerostin with the low density lipoprotein receptor-related protein (LRP) family of Wnt co-receptors." in: The Journal of biological chemistry, Vol. 287, Issue 32, pp. 26464-77, (2012) (PubMed).
-
-
- WNT1 (Wingless-Type MMTV Integration Site Family, Member 1 (WNT1))
-
Alternative Name
- WNT1
-
Background
- The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is very conserved in evolution, and the protein encoded by this gene is known to be 98 % identical to the mouse Wnt1 protein at the amino acid level. The studies in mouse indicate that the Wnt1 protein functions in the induction of the mesencephalon and cerebellum. This gene was originally considered as a candidate gene for Joubert syndrome, an autosomal recessive disorder with cerebellar hypoplasia as a leading feature. However, further studies suggested that the gene mutations might not have a significant role in Joubert syndrome. This gene is clustered with another family member, WNT10B, in the chromosome 12q13 region. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_005430, NP_005421
Target
-
You are here:
