Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human WNT3A cDNA Clone in Mammalian Expression Vector

This is a Wingless-Type MMTV Integration Site Family, Member 3A plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1300 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393102
Supplier Product No.: sc305570
$754.60
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human WNT3A cDNA Clone in Mammalian Expression Vector (ABIN3393102)

Gene

WNT3A (Wingless-Type MMTV Integration Site Family, Member 3A (WNT3A))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc305570

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human WNT3A is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1300 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • De Robertis, Valensin, Rossi, Tunici, Verani, De Rosa, Giordano, Varrone, Nencini, Pratelli, Benicchi, Bakker, Hill, Sangthongpitag, Pendharkar, Liu, Ng, Then, Jing Tai, Cheong, He, Caricasole et al.: "Identification and characterization of a small-molecule inhibitor of Wnt signaling in glioblastoma cells. ..." in: Molecular cancer therapeutics, Vol. 12, Issue 7, pp. 1180-9, (2013) (PubMed).

    Holdsworth, Slocombe, Doyle, Sweeney, Veverka, Le Riche, Franklin, Compson, Brookings, Turner, Kennedy, Garlish, Shi, Newnham, McMillan, Muzylak, Carr, Henry, Ceska, Robinson: "Characterization of the interaction of sclerostin with the low density lipoprotein receptor-related protein (LRP) family of Wnt co-receptors." in: The Journal of biological chemistry, Vol. 287, Issue 32, pp. 26464-77, (2012) (PubMed).

    Cho, Rameshwar, Sadoshima: "Distinct roles of glycogen synthase kinase (GSK)-3alpha and GSK-3beta in mediating cardiomyocyte differentiation in murine bone marrow-derived mesenchymal stem cells." in: The Journal of biological chemistry, Vol. 284, Issue 52, pp. 36647-58, (2009) (PubMed).

  • Target

    WNT3A (Wingless-Type MMTV Integration Site Family, Member 3A (WNT3A))

    Alternative Name

    WNT3A

    Background

    The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 96 % amino acid identity to mouse Wnt3A protein, and 84 % to human WNT3 protein, another WNT gene product. This gene is clustered with WNT14 gene, another family member, in chromosome 1q42 region. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_033131, NP_149122
You are here: