Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human WNT9B cDNA Clone in Mammalian Expression Vector

This is a Wingless-Type MMTV Integration Site Family, Member 9B plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1100 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393105
Supplier Product No.: sc303299
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human WNT9B cDNA Clone in Mammalian Expression Vector (ABIN3393105)

Gene

WNT9B (Wingless-Type MMTV Integration Site Family, Member 9B (WNT9B))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc303299

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human WNT9B is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1100 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Kim, Nie, Nesin, Tran, Outeda, Bai, Keeling, Maskey, Watnick, Wessely, Tsiokas: "The polycystin complex mediates Wnt/Ca(2+) signalling." in: Nature cell biology, Vol. 18, Issue 7, pp. 752-64, (2016) (PubMed).

    Holdsworth, Slocombe, Doyle, Sweeney, Veverka, Le Riche, Franklin, Compson, Brookings, Turner, Kennedy, Garlish, Shi, Newnham, McMillan, Muzylak, Carr, Henry, Ceska, Robinson: "Characterization of the interaction of sclerostin with the low density lipoprotein receptor-related protein (LRP) family of Wnt co-receptors." in: The Journal of biological chemistry, Vol. 287, Issue 32, pp. 26464-77, (2012) (PubMed).

  • Target

    WNT9B (Wingless-Type MMTV Integration Site Family, Member 9B (WNT9B))

    Alternative Name

    WNT9B

    Background

    The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. Study of its expression in the teratocarcinoma cell line NT2 suggests that it may be implicated in the early process of neuronal differentiation of NT2 cells induced by retinoic acid. This gene is clustered with WNT3, another family member, in the chromosome 17q21 region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016].

    NCBI Accession

    NM_003396, NP_003387
You are here: