Human XAGE1B cDNA Clone in Mammalian Expression Vector
Quick Overview for Human XAGE1B cDNA Clone in Mammalian Expression Vector (ABIN3393115)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc316130
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human XAGE1B is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 500 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human XAGE1B ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human XAGE1B ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
![Human XAGE1B ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human XAGE1B ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
![Human XAGE1B ORF Clone in Mammalian Expression Vector (GFP tag)]()
Human XAGE1B ORF Clone in Mammalian Expression Vector (GFP tag)ORF PExp Mammalian Expression Vector pCMV6-AC-GFP Ampicillin CMV Promoter GFP tag Stable
![Human XAGE1B ORF Clone in Mammalian Expression Vector (GFP tag)]()
Human XAGE1B ORF Clone in Mammalian Expression Vector (GFP tag)ORF PExp Mammalian Expression Vector pCMV6-AC-GFP Ampicillin CMV Promoter GFP tag Stable
![Human XAGE1B ORF Clone in Lentiviral Vector (GFP tag)]()
Human XAGE1B ORF Clone in Lentiviral Vector (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human XAGE1B ORF Clone in Lentiviral Vector (Myc-DYKDDDDK Tag)]()
Human XAGE1B ORF Clone in Lentiviral Vector (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- XAGE1B/GAGED2 (XAGE1B) (X Antigen Family, Member 1B (XAGE1B))
-
Alternative Name
- XAGE1B
-
Background
- This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in Ewing's sarcoma, alveolar rhabdomyosarcoma and normal testis. The protein encoded by this gene contains a nuclear localization signal and shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. Alternative splicing of this gene, in addition to alternative transcription start sites, results in multiple transcript variants. [provided by RefSeq, Jan 2010].Transcript Variant: This variant (a, also known as XAGE-1a) encodes the longer isoform (a, also known as isoform XAGE-1b). This variant also includes a major downstream transcription start site, which results in the variant referred to as XAGE-1b in the literature. Both XAGE-1a and XAGE-1b encode the same isoform. This RefSeq contains an in-frame start site 65 codons upstream from the currently annotated site but is not being annotated as a start site since it is in a weak Kozak sequence context and experimental evidence indicates that the downstream AUG is used. (PMID: 12479262 and PMID: 17335148).
-
NCBI Accession
- NM_001097594, NP_001091063
Target
-
