Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human XBP1 cDNA Clone in Mammalian Expression Vector

This is a X-Box Binding Protein 1 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1800 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393119
Supplier Product No.: sc315541
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human XBP1 cDNA Clone in Mammalian Expression Vector (ABIN3393119)

Gene

XBP1 (X-Box Binding Protein 1 (XBP1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc315541

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human XBP1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1800 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Duan, Yang, Gong, Chaugai, Wang, Chen, Wang, Zou, Wang: "MicroRNA-214 Is Upregulated in Heart Failure Patients and Suppresses XBP1-Mediated Endothelial Cells Angiogenesis." in: Journal of cellular physiology, Vol. 230, Issue 8, pp. 1964-73, (2015) (PubMed).

    Hu, Warri, Jin, Zwart, Riggins, Fang, Clarke: "NF-κB signaling is required for XBP1 (unspliced and spliced)-mediated effects on antiestrogen responsiveness and cell fate decisions in breast cancer." in: Molecular and cellular biology, Vol. 35, Issue 2, pp. 379-90, (2014) (PubMed).

  • Target

    XBP1 (X-Box Binding Protein 1 (XBP1))

    Alternative Name

    XBP1

    Background

    This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) lacks a 26 nt segment in the CDS compared to variant 1, that causes a frameshift. The resulting isoform, XBP1(S), has the same N-terminus, but a longer and distinct C-terminus compared to isoform XBP1(U). Isoform XBP1(S) functions as a transcription factor.

    NCBI Accession

    NM_001079539, NP_001073007
You are here: