Human XBP1 cDNA Clone in Mammalian Expression Vector
This is a X-Box Binding Protein 1 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1800 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(2 references)
Catalog No. ABIN3393119
Supplier Product No.: sc315541
$679.14
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 8 Business Days
Quick Overview for Human XBP1 cDNA Clone in Mammalian Expression Vector (ABIN3393119)
Gene
XBP1
(X-Box Binding Protein 1 (XBP1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc315541
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human XBP1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1800 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "MicroRNA-214 Is Upregulated in Heart Failure Patients and Suppresses XBP1-Mediated Endothelial Cells Angiogenesis." in: Journal of cellular physiology, Vol. 230, Issue 8, pp. 1964-73, (2015) (PubMed).
: "NF-κB signaling is required for XBP1 (unspliced and spliced)-mediated effects on antiestrogen responsiveness and cell fate decisions in breast cancer." in: Molecular and cellular biology, Vol. 35, Issue 2, pp. 379-90, (2014) (PubMed).
-
: "MicroRNA-214 Is Upregulated in Heart Failure Patients and Suppresses XBP1-Mediated Endothelial Cells Angiogenesis." in: Journal of cellular physiology, Vol. 230, Issue 8, pp. 1964-73, (2015) (PubMed).
-
- XBP1 (X-Box Binding Protein 1 (XBP1))
-
Alternative Name
- XBP1
-
Background
- This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) lacks a 26 nt segment in the CDS compared to variant 1, that causes a frameshift. The resulting isoform, XBP1(S), has the same N-terminus, but a longer and distinct C-terminus compared to isoform XBP1(U). Isoform XBP1(S) functions as a transcription factor.
-
NCBI Accession
- NM_001079539, NP_001073007
Target
-
You are here:
