Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human YTHDF2 cDNA Clone in Mammalian Expression Vector

This is a YTH Domain Family, Member 2 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: not_set. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393130
Supplier Product No.: sc328872
$537.57
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 21 to 22 Business Days

Quick Overview for Human YTHDF2 cDNA Clone in Mammalian Expression Vector (ABIN3393130)

Gene

YTHDF2 (YTH Domain Family, Member 2 (YTHDF2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc328872

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human YTHDF2 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    YTHDF2 (YTH Domain Family, Member 2 (YTHDF2))

    Alternative Name

    YTHDF2

    Background

    This gene encodes a member of the YTH (YT521-B homology) superfamily containing YTH domain. The YTH domain is typical for the eukaryotes and is particularly abundant in plants. The YTH domain is usually located in the middle of the protein sequence and may function in binding to RNA. In addition to a YTH domain, this protein has a proline rich region which may be involved in signal transduction. An Alu-rich domain has been identified in one of the introns of this gene, which is thought to be associated with human longevity. In addition, reciprocal translocations between this gene and the Runx1 (AML1) gene on chromosome 21 has been observed in patients with acute myeloid leukemia. This gene was initially mapped to chromosome 14, which was later turned out to be a pseudogene. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Oct 2012].Transcript Variant: This variant (3) lacks an exon in the 5' region, which results in a downstream AUG start codon, as compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, as compared to isoform 1.

    NCBI Accession

    NM_001172828, NP_001166299
You are here: