Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human STAT5B cDNA Clone in Mammalian Expression Vector

This is a Signal Transducer and Activator of Transcription 5B plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 2750 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393332
Supplier Product No.: sc115355
$1,071.18
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human STAT5B cDNA Clone in Mammalian Expression Vector (ABIN3393332)

Gene

STAT5B (Signal Transducer and Activator of Transcription 5B (STAT5B))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL6

Promoter

Enhanced CMV Promoter, SP6 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc115355

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human STAT5B is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: ECoRI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2750 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Rajala, Eldfors, Kuusanmäki, van Adrichem, Olson, Lagström, Andersson, Jerez, Clemente, Yan, Zhang, Awwad, Ellonen, Kallioniemi, Wennerberg, Porkka, Maciejewski, Loughran, Heckman, Mustjoki: "Discovery of somatic STAT5b mutations in large granular lymphocytic leukemia." in: Blood, Vol. 121, Issue 22, pp. 4541-50, (2013) (PubMed).

    Mitra, Ross, Rodriguez, Nagy, Wilson, Kirken: "Signal transducer and activator of transcription 5b (Stat5b) serine 193 is a novel cytokine-induced phospho-regulatory site that is constitutively activated in primary hematopoietic malignancies." in: The Journal of biological chemistry, Vol. 287, Issue 20, pp. 16596-608, (2012) (PubMed).

  • Target

    STAT5B (Signal Transducer and Activator of Transcription 5B (STAT5B))

    Alternative Name

    STAT5B

    Background

    The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein mediates the signal transduction triggered by various cell ligands, such as IL2, IL4, CSF1, and different growth hormones. It has been shown to be involved in diverse biological processes, such as TCR signaling, apoptosis, adult mammary gland development, and sexual dimorphism of liver gene expression. This gene was found to fuse to retinoic acid receptor-alpha (RARA) gene in a small subset of acute promyelocytic leukemias (APLL). The dysregulation of the signaling pathways mediated by this protein may be the cause of the APLL. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_012448, NP_036580
You are here: