Human CDK6 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human CDK6 cDNA Clone in Mammalian Expression Vector (ABIN3393419)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc119341
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CDK6 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 600 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "CDK4 Amplification Reduces Sensitivity to CDK4/6 Inhibition in Fusion-Positive Rhabdomyosarcoma." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 21, Issue 21, pp. 4947-59, (2015) (PubMed).
: "Androgen Receptor-Mediated Growth Suppression of HPr-1AR and PC3-Lenti-AR Prostate Epithelial Cells." in: PLoS ONE, Vol. 10, Issue 9, pp. e0138286, (2015) (PubMed).
-
-
- CDK6 (Cyclin-Dependent Kinase 6 (CDK6))
-
Alternative Name
- CDK6
-
Background
- The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This kinase is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression and G1/S transition. The activity of this kinase first appears in mid-G1 phase, which is controlled by the regulatory subunits including D-type cyclins and members of INK4 family of CDK inhibitors. This kinase, as well as CDK4, has been shown to phosphorylate, and thus regulate the activity of, tumor suppressor protein Rb. Expression of this gene is up-regulated in some types of cancer. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009].Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.
-
NCBI Accession
- NM_001259, NP_001250
Target
-