Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CDK6 cDNA Clone in Mammalian Expression Vector

This is a Cyclin-Dependent Kinase 6 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 600 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393419
Supplier Product No.: sc119341
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 31 to 32 Business Days

Quick Overview for Human CDK6 cDNA Clone in Mammalian Expression Vector (ABIN3393419)

Gene

CDK6 (Cyclin-Dependent Kinase 6 (CDK6))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL6

Promoter

Enhanced CMV Promoter, SP6 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119341

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CDK6 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    600 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Olanich, Sun, Hewitt, Abdullaev, Pack, Barr: "CDK4 Amplification Reduces Sensitivity to CDK4/6 Inhibition in Fusion-Positive Rhabdomyosarcoma." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 21, Issue 21, pp. 4947-59, (2015) (PubMed).

    Kim, Chen, Bolton: "Androgen Receptor-Mediated Growth Suppression of HPr-1AR and PC3-Lenti-AR Prostate Epithelial Cells." in: PLoS ONE, Vol. 10, Issue 9, pp. e0138286, (2015) (PubMed).

  • Target

    CDK6 (Cyclin-Dependent Kinase 6 (CDK6))

    Alternative Name

    CDK6

    Background

    The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This kinase is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression and G1/S transition. The activity of this kinase first appears in mid-G1 phase, which is controlled by the regulatory subunits including D-type cyclins and members of INK4 family of CDK inhibitors. This kinase, as well as CDK4, has been shown to phosphorylate, and thus regulate the activity of, tumor suppressor protein Rb. Expression of this gene is up-regulated in some types of cancer. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009].Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.

    NCBI Accession

    NM_001259, NP_001250
You are here: