Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CRTC2 cDNA Clone in Mammalian Expression Vector

This is a CREB Regulated Transcription Coactivator 2 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 2750 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393446
Supplier Product No.: sc107319
$629.64
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CRTC2 cDNA Clone in Mammalian Expression Vector (ABIN3393446)

Gene

CRTC2 (CREB Regulated Transcription Coactivator 2 (CRTC2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL6

Promoter

Enhanced CMV Promoter, SP6 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc107319

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CRTC2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2750 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Yuan, Liu, Wu, McGonagill, Keller, Galle, Meier et al.: "Breaking human cytomegalovirus major immediate-early gene silence by vasoactive intestinal peptide stimulation of the protein kinase A-CREB-TORC2 signaling cascade in human pluripotent embryonal ..." in: Journal of virology, Vol. 83, Issue 13, pp. 6391-403, (2009) (PubMed).

    Ohmae, Takemoto-Kimura, Okamura, Adachi-Morishima, Nonaka, Fuse, Kida, Tanji, Furuyashiki, Arakawa, Narumiya, Okuno, Bito: "Molecular identification and characterization of a family of kinases with homology to Ca2+/calmodulin-dependent protein kinases I/IV." in: The Journal of biological chemistry, Vol. 281, Issue 29, pp. 20427-39, (2006) (PubMed).

  • Target

    CRTC2 (CREB Regulated Transcription Coactivator 2 (CRTC2))

    Alternative Name

    CRTC2

    Background

    This gene encodes a member of the transducers of regulated cAMP response element-binding protein activity family of transcription coactivators. These proteins promote the transcription of genes targeted by the cAMP response element-binding protein, and therefore play an important role in many cellular processes. Under basal conditions the encoded protein is phosphorylated by AMP-activated protein kinase or the salt-inducible kinases and is sequestered in the cytoplasm. Upon activation by elevated cAMP or calcium, the encoded protein translocates to the nucleus and increases target gene expression. Single nucleotide polymorphisms in this gene may increase the risk of type 2 diabetes. A pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2010].

    NCBI Accession

    NM_181715, NP_859066
You are here: