Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human DDR2 cDNA Clone in Mammalian Expression Vector

This is a Discoidin Domain Receptor tyrosine Kinase 2 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 3100 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393454
Supplier Product No.: sc301955
$776.16
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 2 to 4 Business Days

Quick Overview for Human DDR2 cDNA Clone in Mammalian Expression Vector (ABIN3393454)

Gene

DDR2 (Discoidin Domain Receptor tyrosine Kinase 2 (DDR2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL6

Promoter

Enhanced CMV Promoter, SP6 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc301955

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human DDR2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3100 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Xie, Lin, Ye, Wang, Zhang, Xiong, Li, Tan: "DDR2 facilitates hepatocellular carcinoma invasion and metastasis via activating ERK signaling and stabilizing SNAIL1." in: Journal of experimental & clinical cancer research : CR, Vol. 34, pp. 101, (2015) (PubMed).

    Hammerman, Sos, Ramos, Xu, Dutt, Zhou, Brace, Woods, Lin, Zhang, Deng, Lim, Heynck, Peifer, Simard, Lawrence, Onofrio, Salvesen, Seidel, Zander, Heuckmann, Soltermann, Moch, Koker, Leenders, Gabler et al.: "Mutations in the DDR2 kinase gene identify a novel therapeutic target in squamous cell lung cancer. ..." in: Cancer discovery, Vol. 1, Issue 1, pp. 78-89, (2012) (PubMed).

  • Target

    DDR2 (Discoidin Domain Receptor tyrosine Kinase 2 (DDR2))

    Alternative Name

    DDR2

    Background

    Receptor tyrosine kinases (RTKs) play a key role in the communication of cells with their microenvironment. These molecules are involved in the regulation of cell growth, differentiation, and metabolism. In several cases the biochemical mechanism by which RTKs transduce signals across the membrane has been shown to be ligand induced receptor oligomerization and subsequent intracellular phosphorylation. This autophosphorylation leads to phosphorylation of cytosolic targets as well as association with other molecules, which are involved in pleiotropic effects of signal transduction. RTKs have a tripartite structure with extracellular, transmembrane, and cytoplasmic regions. This gene encodes a member of a novel subclass of RTKs and contains a distinct extracellular region encompassing a factor VIII-like domain. Alternative splicing in the 5' UTR results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) represents the longest transcript.

    NCBI Accession

    NM_001014796, NP_001014796
You are here: