Human DMD cDNA Clone in Mammalian Expression Vector
This is a Dystrophin plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 5000 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
Catalog No. ABIN3393465
Supplier Product No.: sc124994
$574.20
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 21 to 22 Business Days
Quick Overview for Human DMD cDNA Clone in Mammalian Expression Vector (ABIN3393465)
Gene
Dystrophin (DMD)
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL6
Promoter
Enhanced CMV Promoter, SP6 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc124994
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human DMD is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 5000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- Dystrophin (DMD)
-
Alternative Name
- DMD
-
Background
- The dystrophin gene is the largest gene found in nature, measuring 2.4 Mb. The gene was identified through a positional cloning approach, targeted at the isolation of the gene responsible for Duchenne (DMD) and Becker (BMD) Muscular Dystrophies. DMD is a recessive, fatal, X-linked disorder occurring at a frequency of about 1 in 3,500 new-born males. BMD is a milder allelic form. In general, DMD patients carry mutations which cause premature translation termination (nonsense or frame shift mutations), while in BMD patients dystrophin is reduced either in molecular weight (derived from in-frame deletions) or in expression level. The dystrophin gene is highly complex, containing at least eight independent, tissue-specific promoters and two polyA-addition sites. Furthermore, dystrophin RNA is differentially spliced, producing a range of different transcripts, encoding a large set of protein isoforms. Dystrophin (as encoded by the Dp427 transcripts) is a large, rod-like cytoskeletal protein which is found at the inner surface of muscle fibers. Dystrophin is part of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton (F-actin) and the extra-cellular matrix. [provided by RefSeq, Jul 2008].Transcript Variant: Dp71 transcripts use exons 63-79 with a novel 80- to 100-nt exon containing an ATG start site for a new coding sequence of 17 nt. The short coding sequence is in-frame with the consecutive dystrophin sequence from exon 63. Differential splicing of exons 71 and 78 produces at least four Dp71 isoforms. Of these, this transcript (Dp71ab) lacks both exons 71 and 78 and encodes a protein with a C-terminus like isoform Dp71b.
-
NCBI Accession
- NM_004018, NP_004009
Target
-
You are here:
