Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human EPHB4 cDNA Clone in Mammalian Expression Vector

This is a EPH Receptor B4 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 4700 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393493
Supplier Product No.: sc117357
$895.95
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human EPHB4 cDNA Clone in Mammalian Expression Vector (ABIN3393493)

Gene

EPH Receptor B4 (EPHB4)

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL6

Promoter

Enhanced CMV Promoter, SP6 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc117357

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human EPHB4 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4700 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Martin-Almedina, Martinez-Corral, Holdhus, Vicente, Fotiou, Lin, Petersen, Simpson, Hoischen, Gilissen, Jeffery, Atton, Karapouliou, Brice, Gordon, Wiseman, Wedin, Rockson, Jeffery, Mortimer, Snyder et al.: "EPHB4 kinase-inactivating mutations cause autosomal dominant lymphatic-related hydrops fetalis. ..." in: The Journal of clinical investigation, Vol. 126, Issue 8, pp. 3080-8, (2016) (PubMed).

    Allonby, El Zawily, Freywald, Mousseau, Chlan, Anderson, Benmerah, Sidhu, Babu, DeCoteau, Freywald: "Ligand stimulation induces clathrin- and Rab5-dependent downregulation of the kinase-dead EphB6 receptor preceded by the disruption of EphB6-Hsp90 interaction." in: Cellular signalling, Vol. 26, Issue 12, pp. 2645-57, (2014) (PubMed).

    Truitt, Freywald, DeCoteau, Sharfe, Freywald: "The EphB6 receptor cooperates with c-Cbl to regulate the behavior of breast cancer cells." in: Cancer research, Vol. 70, Issue 3, pp. 1141-53, (2010) (PubMed).

  • Target

    EPH Receptor B4 (EPHB4)

    Alternative Name

    EPHB4

    Background

    Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_004444, NP_004435
You are here: