Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human EXOSC7 cDNA Clone in Mammalian Expression Vector

This is a Exosome Component 7 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 1200 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393497
Supplier Product No.: sc101005
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human EXOSC7 cDNA Clone in Mammalian Expression Vector (ABIN3393497)

Gene

EXOSC7 (Exosome Component 7 (EXOSC7))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL6

Promoter

Enhanced CMV Promoter, SP6 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc101005

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human EXOSC7 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1200 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    EXOSC7 (Exosome Component 7 (EXOSC7))

    Alternative Name

    EXOSC7

    Background

    Non-catalytic component of the RNA exosome complex which has 3'->5' exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding 'pervasive' transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3' untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. The catalytic inactive RNA exosome core complex of 9 subunits (Exo-9) is proposed to play a pivotal role in the binding and presentation of RNA for ribonucleolysis, and to serve as a scaffold for the association with catalytic subunits and accessory proteins or complexes. [UniProtKB/Swiss-Prot Function]Transcript Variant: This variant (1) encodes the protein.

    NCBI Accession

    NM_015004, NP_055819
You are here: