Human FURIN cDNA Clone in Mammalian Expression Vector
This is a Furin (Paired Basic Amino Acid Cleaving Enzyme) plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 4600 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(2 references)
Catalog No. ABIN3393525
Supplier Product No.: sc118550
$1,081.08
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human FURIN cDNA Clone in Mammalian Expression Vector (ABIN3393525)
Gene
FURIN
(Furin (Paired Basic Amino Acid Cleaving Enzyme) (FURIN))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL6
Promoter
Enhanced CMV Promoter, SP6 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc118550
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human FURIN is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 4600 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "The eukaryotic signal sequence, YGRL, targets the chlamydial inclusion." in: Frontiers in cellular and infection microbiology, Vol. 4, pp. 129, (2014) (PubMed).
: "Characterization of genotype-specific carboxyl-terminal cleavage sites of hepatitis B virus e antigen precursor and identification of furin as the candidate enzyme." in: Journal of virology, Vol. 83, Issue 8, pp. 3507-17, (2009) (PubMed).
-
-
- FURIN (Furin (Paired Basic Amino Acid Cleaving Enzyme) (FURIN))
-
Alternative Name
- FURIN
-
Background
- This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. It encodes a type 1 membrane bound protease that is expressed in many tissues, including neuroendocrine, liver, gut, and brain. The encoded protein undergoes an initial autocatalytic processing event in the ER and then sorts to the trans-Golgi network through endosomes where a second autocatalytic event takes place and the catalytic activity is acquired. The product of this gene is one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. Some of its substrates include proparathyroid hormone, transforming growth factor beta 1 precursor, proalbumin, pro-beta-secretase, membrane type-1 matrix metalloproteinase, beta subunit of pro-nerve growth factor and von Willebrand factor. It is also thought to be one of the proteases responsible for the activation of HIV envelope glycoproteins gp160 and gp140 and may play a role in tumor progression. This gene is located in close proximity to family member proprotein convertase subtilisin/kexin type 6 and upstream of the FES oncogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014].Transcript Variant: This variant (1) represents the predominant transcript. Variants 1, 2, and 3 encode the same protein.
-
NCBI Accession
- NM_002569, NP_002560
Target
-
You are here:
