Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human FZD4 cDNA Clone in Mammalian Expression Vector

This is a Frizzled Family Receptor 4 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 4700 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393526
Supplier Product No.: sc115479
$743.49
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human FZD4 cDNA Clone in Mammalian Expression Vector (ABIN3393526)

Gene

FZD4 (Frizzled Family Receptor 4 (FZD4))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL6

Promoter

Enhanced CMV Promoter, SP6 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc115479

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human FZD4 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4700 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Gupta, Iljin, Sara, Mpindi, Mirtti, Vainio, Rantala, Alanen, Nees, Kallioniemi: "FZD4 as a mediator of ERG oncogene-induced WNT signaling and epithelial-to-mesenchymal transition in human prostate cancer cells." in: Cancer research, Vol. 70, Issue 17, pp. 6735-45, (2010) (PubMed).

    Kawano, Diez, Uysal-Onganer, Darrington, Waxman, Kypta: "Secreted Frizzled-related protein-1 is a negative regulator of androgen receptor activity in prostate cancer." in: British journal of cancer, Vol. 100, Issue 7, pp. 1165-74, (2009) (PubMed).

    Binnerts, Kim, Bright, Patel, Tran, Zhou, Leung, Liu, Lomas, Dixon, Hazell, Wagle, Nie, Tomasevic, Williams, Zhan, Levy, Funk, Abo: "R-Spondin1 regulates Wnt signaling by inhibiting internalization of LRP6." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 104, Issue 37, pp. 14700-5, (2007) (PubMed).

  • Target

    FZD4 (Frizzled Family Receptor 4 (FZD4))

    Alternative Name

    FZD4

    Background

    This gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This protein may play a role as a positive regulator of the Wingless type MMTV integration site signaling pathway. A transcript variant retaining intronic sequence and encoding a shorter isoform has been described, however, its expression is not supported by other experimental evidence. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_012193, NP_036325
You are here: