Human NPR1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human NPR1 cDNA Clone in Mammalian Expression Vector (ABIN3393669)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc125506
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human NPR1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3940 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Knockdown of natriuretic peptide receptor-A enhances receptor C expression and signalling in vascular smooth muscle cells." in: Cardiovascular research, Vol. 93, Issue 2, pp. 350-9, (2012) (PubMed).
: "Competitive binding of musclin to natriuretic peptide receptor 3 with atrial natriuretic peptide." in: The Journal of endocrinology, Vol. 201, Issue 2, pp. 287-95, (2009) (PubMed).
: "Successive action of meprin A and neprilysin catabolizes B-type natriuretic peptide." in: Circulation research, Vol. 101, Issue 9, pp. 875-82, (2007) (PubMed).
-
-
- NPR1 (Natriuretic Peptide Receptor A/guanylate Cyclase A (Atrionatriuretic Peptide Receptor A) (NPR1))
-
Alternative Name
- NPR1
-
Background
- Guanylyl cyclases, catalyzing the production of cGMP from GTP, are classified as soluble and membrane forms (Garbers and Lowe, 1994 [PubMed 7982997]). The membrane guanylyl cyclases, often termed guanylyl cyclases A through F, form a family of cell-surface receptors with a similar topographic structure: an extracellular ligand-binding domain, a single membrane-spanning domain, and an intracellular region that contains a protein kinase-like domain and a cyclase catalytic domain. GC-A and GC-B function as receptors for natriuretic peptides, they are also referred to as atrial natriuretic peptide receptor A (NPR1) and type B (NPR2, MIM 108961). Also see NPR3 (MIM 108962), which encodes a protein with only the ligand-binding transmembrane and 37-amino acid cytoplasmic domains. NPR1 is a membrane-bound guanylate cyclase that serves as the receptor for both atrial and brain natriuretic peptides (ANP (MIM 108780) and BNP (MIM 600295), respectively).[supplied by OMIM, May 2009].
-
NCBI Accession
- NM_000906, NP_000897
Target
-