Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human NPR1 cDNA Clone in Mammalian Expression Vector

This is a Natriuretic Peptide Receptor A/guanylate Cyclase A (Atrionatriuretic Peptide Receptor A) plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 3940 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393669
Supplier Product No.: sc125506
$914.76
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human NPR1 cDNA Clone in Mammalian Expression Vector (ABIN3393669)

Gene

NPR1 (Natriuretic Peptide Receptor A/guanylate Cyclase A (Atrionatriuretic Peptide Receptor A) (NPR1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL6

Promoter

Enhanced CMV Promoter, SP6 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc125506

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human NPR1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3940 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Li, Madiraju, Anand-Srivastava: "Knockdown of natriuretic peptide receptor-A enhances receptor C expression and signalling in vascular smooth muscle cells." in: Cardiovascular research, Vol. 93, Issue 2, pp. 350-9, (2012) (PubMed).

    Kita, Nishizawa, Okuno, Tanaka, Yasui, Matsuda, Yamada, Shimomura: "Competitive binding of musclin to natriuretic peptide receptor 3 with atrial natriuretic peptide." in: The Journal of endocrinology, Vol. 201, Issue 2, pp. 287-95, (2009) (PubMed).

    Pankow, Wang, Gembardt, Krause, Sun, Krause, Schultheiss, Siems, Walther: "Successive action of meprin A and neprilysin catabolizes B-type natriuretic peptide." in: Circulation research, Vol. 101, Issue 9, pp. 875-82, (2007) (PubMed).

  • Target

    NPR1 (Natriuretic Peptide Receptor A/guanylate Cyclase A (Atrionatriuretic Peptide Receptor A) (NPR1))

    Alternative Name

    NPR1

    Background

    Guanylyl cyclases, catalyzing the production of cGMP from GTP, are classified as soluble and membrane forms (Garbers and Lowe, 1994 [PubMed 7982997]). The membrane guanylyl cyclases, often termed guanylyl cyclases A through F, form a family of cell-surface receptors with a similar topographic structure: an extracellular ligand-binding domain, a single membrane-spanning domain, and an intracellular region that contains a protein kinase-like domain and a cyclase catalytic domain. GC-A and GC-B function as receptors for natriuretic peptides, they are also referred to as atrial natriuretic peptide receptor A (NPR1) and type B (NPR2, MIM 108961). Also see NPR3 (MIM 108962), which encodes a protein with only the ligand-binding transmembrane and 37-amino acid cytoplasmic domains. NPR1 is a membrane-bound guanylate cyclase that serves as the receptor for both atrial and brain natriuretic peptides (ANP (MIM 108780) and BNP (MIM 600295), respectively).[supplied by OMIM, May 2009].

    NCBI Accession

    NM_000906, NP_000897
You are here: