Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human ZNF278 cDNA Clone in Mammalian Expression Vector

This is a Zinc Finger Protein 278 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL6. Insert length: 3500 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3393678
Supplier Product No.: sc124801
$495.99
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human ZNF278 cDNA Clone in Mammalian Expression Vector (ABIN3393678)

Gene

PATZ1 (ZNF278) (Zinc Finger Protein 278 (ZNF278))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL6

Promoter

Enhanced CMV Promoter, SP6 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc124801

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PATZ1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3500 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    PATZ1 (ZNF278) (Zinc Finger Protein 278 (ZNF278))

    Alternative Name

    PATZ1

    Background

    The protein encoded by this gene contains an A-T hook DNA binding motif which usually binds to other DNA binding structures to play an important role in chromatin modeling and transcription regulation. Its Poz domain is thought to function as a site for protein-protein interaction and is required for transcriptional repression, and the zinc-fingers comprise the DNA binding domain. Since the encoded protein has typical features of a transcription factor, it is postulated to be a repressor of gene expression. In small round cell sarcoma, this gene is fused to EWS by a small inversion of 22q, then the hybrid is thought to be translocated (t(1,22)(p36.1,q12). The rearrangement of chromosome 22 involves intron 8 of EWS and exon 1 of this gene creating a chimeric sequence containing the transactivation domain of EWS fused to zinc finger domain of this protein. This is a distinct example of an intra-chromosomal rearrangement of chromosome 22. Four alternatively spliced transcript variants are described for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes the long B isoform which has a shorter and distinct C-terminus compared to the lonc C isoform.

    NCBI Accession

    NM_032052, NP_114441
You are here: